how to f inished the Blood DNA Extraction in 8minutes
December 20, 2023
The hot summer weather makes people feel irritable . Wouldn't it be a tedious and complicated experiment to add fuel to the fire? Whenever it's so hot that you don't want to move, some students will definitely think about how great it would be if their DNA could be extracted with just a "snap". Today, We brings you a rapid blood DNA extraction kit. Different from the common kits on the market that start with 30 minutes , our rapid blood DNA extraction kit (Cat . No 3003050) only need in 8 minutes, our last generation kits keeps records of blood DNA extraction ( Whole Blood DNA Mini Kit, Cat . No. 3001050 ) within 15 minutes . What’s even more amazing is that 600 μl of DNA from blood was extracted within 8 minutes ! ! ! You must know that blood DNA extraction kits from companies su1ch as Q IAGEN and others can extract only 200 μl of DNA from blood in 30 mins ..., let us take a look at how effective the extraction of our products

一、Experimental Materials
Human whole blood (EDTA anticoagulated) , Rapid Whole Blood DNA Mini Kit (Simgen Cat.No.3003050), 2×PCR Mix (Simgen Cat.No.7003100) , 1.3 kb β-globin primer (F: TTAGGCCTTAGCGGGCTTAGAC /R: CCAGGATTTTTGATGGGACACG)
Vortex oscillator (Yexin Instruments, XH-C)
Desktop centrifuge (eppendorf centrifuge 5415 D)
Ultra-micro-volume spectrophotometer (Simgen Cat.No.sim100)
Electrophoresis instrument (Beijing Liuyi Instrument Factory, DYY-6C type)
PCR machine (Techne FPROG5Y Progene Thermal)
二、Experimental steps
(1) DNA extraction
1. Add 600 μl Buffer L7 to a 1.5 ml centrifuge tube, then add 600 μl whole blood (EDTA anticoagulation), mix vigorously 3 to 5 times immediately to form a brown precipitate in the blood sample, then vortex for 30 seconds to mix evenly to precipitate Things are completely dispersed.
2. Centrifuge at 13200 rpm for 1 minute.
3. Pour all the supernatant in step 2 into the nucleic acid purification column (the nucleic acid purification column is placed in a 2 ml centrifuge tube), cover the tube cap, and centrifuge at 12,000 rpm for 30 seconds.
4. Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, add 800 μl Buffer WB to the nucleic acid purification column, cap the tube, and centrifuge at 12,000 rpm for 30 seconds.
5. Discard the filtrate in the 2 ml centrifuge tube, place the nucleic acid purification column back into the 2 ml centrifuge tube, and centrifuge at 13200 rpm for 1 minute.
6. Discard the 2 ml centrifuge tube, place the nucleic acid purification column in a clean 1.5 ml centrifuge tube, add 100 μl Buffer TE to the purification column, cover the tube, let it stand at room temperature for 1 minute, and centrifuge at 12000 rpm for 30 seconds to obtain whole blood DNA
(二)PCR amplification
PCR amplification system:
Reagents | Dosage/tube |
2×PCR Mix | 20 μl |
PrimerF /R | 1 μl/1 μl |
DNA template | 18 μl |
Amplification procedure :
94℃,5 min,{94℃,45 sec;55℃,45 sec;72℃,1 min 30 sec}×30 cycles,72℃,10 min.

三、Experimental results
1. Use Buffer TE to zero on the ultra-micro-volume spectrophotometer and measure the extracted DNA. The results are as follows:
serial number | Abs260 | Abs280 | Abs230 | 260/230 | 260/280 | Sample concentration | unit |
1 | 1.942 | 1.105 | 1.003 | 1.94 | 1.76 | 97.1198 | ng/µl |
2 | 2.076 | 1.193 | 0.982 | 2.11 | 1.74 | 103.782 | ng/µl |
3 | 2.368 | 1.343 | 1.084 | 2.18 | 1.76 | 118.4171 | ng/µl |
4 | 1.841 | 1.063 | 0.856 | 2.15 | 1.73 | 92.0697 | ng/µl |
2. Add 5 to a 1% agarose gel μl of extracted DNA/amplification product was electrophoresed, and the results are as follows:
四、Analysis and Discussion
1. From the operation steps, it can be calculated that the actual indicated time is 5 minutes in total, plus the 3 minutes lost in the linking process, the 8 minutes to complete the blood DNA extraction is genuine, and there is indeed no exaggeration.
2. From the concentration measurement results and the electrophoresis results in Figure 1 , it can be seen that the whole blood DNA extracted with the Rapid Whole Blood DNA Mini Kit has good purity, high concentration, clear and complete bands, and no degradation.
3. As can be seen from Figure 2, at 40 Use 18 in μl amplification system µl of extracted DNA (excess template test) was used as a template for amplification. The amplification results were consistent with the positive control, and no obvious inhibitory effect was observed. This further illustrates that the whole blood DNA extracted with the Rapid Whole Blood DNA Mini Kit It has good purity and few inhibitors, and can fully meet the needs of subsequent experiments .
Therefore ,looking for you have a try of our Rapid Whole Blood DNA Mini Kit, Enjoy the wonderful process of extracting high-purity whole blood DNA quickly (8 minutes) and in large quantities (up to 600 μl ) ---our kit makes experiments simpler and faster .

